Genotyping method and frequency of single nucleotide polymorphism rs12970134 near melanocortin-4 receptor genotypes in hanoi preschool chidren population

Melanocortin-4 receptor is part of the central melanocortinergic system and plays critical roles in central

regulation of food intake, energy homeostasis and body weight, so that this gene is related to obesity

and insulin resistance including single nucleotide polymorphism rs12970134. Thus, this study aimed to

find out a protocol for genotyping rs12970134 near Melanocortin-4 receptor by AS-PCR method,

analyzing the genotype and allele ratios of this single nucleotide polymorphism in 200 3-5 years old

children in Hanoi, Vietnam (50% boys). This protocol used the forward primers including 5’-

tcttaccaaacaaagcatgtg-3’ to detect allele G, and 5’-tcttaccaaacaaagcatgta-3’ to detect allele A; and the

reverse primer 5’-gtcattcccactaccacctg-3’. The optimized PCR protocol was that 94oC for 3 min and 34

cycles of denaturation at 94oC for 30 sec, primer annealing at 54oC for 40 sec, primer extension at 72oC

for 30 sec, final extension at 72oC for 8 min, stopped by chilling at 4oC. The 208 bp PCR products were

detected on Redsafe-stained 2.5% agarose gel. The results were verified by using the sequencing

method. In the entire samples, the GG genotype was the largest (57.5%), and the AA genotype was the

lowest (4%). The frequencies of the G and A alleles were 0.77 and 0.23, respectively.

Genotyping method and frequency of single nucleotide polymorphism rs12970134 near melanocortin-4 receptor genotypes in hanoi preschool chidren population trang 1

Trang 1

Genotyping method and frequency of single nucleotide polymorphism rs12970134 near melanocortin-4 receptor genotypes in hanoi preschool chidren population trang 2

Trang 2

Genotyping method and frequency of single nucleotide polymorphism rs12970134 near melanocortin-4 receptor genotypes in hanoi preschool chidren population trang 3

Trang 3

Genotyping method and frequency of single nucleotide polymorphism rs12970134 near melanocortin-4 receptor genotypes in hanoi preschool chidren population trang 4

Trang 4

Genotyping method and frequency of single nucleotide polymorphism rs12970134 near melanocortin-4 receptor genotypes in hanoi preschool chidren population trang 5

Trang 5

Genotyping method and frequency of single nucleotide polymorphism rs12970134 near melanocortin-4 receptor genotypes in hanoi preschool chidren population trang 6

Trang 6

Genotyping method and frequency of single nucleotide polymorphism rs12970134 near melanocortin-4 receptor genotypes in hanoi preschool chidren population trang 7

Trang 7

pdf 7 trang baonam 27660 Free
Bạn đang xem tài liệu "Genotyping method and frequency of single nucleotide polymorphism rs12970134 near melanocortin-4 receptor genotypes in hanoi preschool chidren population", để tải tài liệu gốc về máy hãy click vào nút Download ở trên

Tóm tắt nội dung tài liệu: Genotyping method and frequency of single nucleotide polymorphism rs12970134 near melanocortin-4 receptor genotypes in hanoi preschool chidren population

Genotyping method and frequency of single nucleotide polymorphism rs12970134 near melanocortin-4 receptor genotypes in hanoi preschool chidren population
 ISSN: 1859-2171 
e-ISSN: 2615-9562 
TNU Journal of Science and Technology 225(05): 38 - 44 
38  Email: [email protected] 
GENOTYPING METHOD AND FREQUENCY OF SINGLE NUCLEOTIDE 
POLYMORPHISM RS12970134 NEAR MELANOCORTIN-4 RECEPTOR 
GENOTYPES IN HANOI PRESCHOOL CHIDREN POPULATION 
Nguyen Thi Trung Thu, Le Thi Tuyet
* 
Hanoi National University of Education 
ABSTRACT 
Melanocortin-4 receptor is part of the central melanocortinergic system and plays critical roles in central 
regulation of food intake, energy homeostasis and body weight, so that this gene is related to obesity 
and insulin resistance including single nucleotide polymorphism rs12970134. Thus, this study aimed to 
find out a protocol for genotyping rs12970134 near Melanocortin-4 receptor by AS-PCR method, 
analyzing the genotype and allele ratios of this single nucleotide polymorphism in 200 3-5 years old 
children in Hanoi, Vietnam (50% boys). This protocol used the forward primers including 5’-
tcttaccaaacaaagcatgtg-3’ to detect allele G, and 5’-tcttaccaaacaaagcatgta-3’ to detect allele A; and the 
reverse primer 5’-gtcattcccactaccacctg-3’. The optimized PCR protocol was that 94oC for 3 min and 34 
cycles of denaturation at 94
o
C for 30 sec, primer annealing at 54
o
C for 40 sec, primer extension at 72
o
C 
for 30 sec, final extension at 72
o
C for 8 min, stopped by chilling at 4
o
C. The 208 bp PCR products were 
detected on Redsafe-stained 2.5% agarose gel. The results were verified by using the sequencing 
method. In the entire samples, the GG genotype was the largest (57.5%), and the AA genotype was the 
lowest (4%). The frequencies of the G and A alleles were 0.77 and 0.23, respectively. 
Key words: Melanocortin-4 receptor; single nucleotide polymorphism; rs12970134; AS-PCR 
method; preschool children. 
Received: 09/02/2020; Revised: 27/4/2020; Published: 28/4/2020 
PHƯƠNG PHÁP PHÂN TÍCH KIỂU GEN VÀ TẦN SỐ ALEN CỦA ĐA HÌNH 
NUCLEOTIDE ĐƠN RS12970134 GẦN THỤ THỂ MELANOCORTIN-4 
Ở TRẺ MẦM NON TẠI HÀ NỘI 
Nguyễn Thị Trung Thu, Lê Thị Tuyết* 
Trường Đại học Sư phạm Hà Nội 
TÓM TẮT 
Thụ thể Melanocortin-4 có liên quan đến bệnh béo phì, kháng insulin do đóng vai trò quan trọng 
trong việc điều hòa lượng thức ăn ăn vào, cân bằng nội môi và khối lượng cơ thể. Mục tiêu của 
nghiên cứu này là xây dựng được phương pháp AS-PCR phân tích kiểu gen của đa hình nucleotide 
đơn rs12970134 gần thụ thể Melanocortin-4 và xác định tỉ lệ alen của đa hình nucleotide đơn này 
ở trẻ em 3-5 tuổi tại Hà Nội. Nghiên cứu đã thiết kế được các đoạn mồi để xác định alen của đa 
hình nucleotide đơn rs12970314 gồm mồi xuôi phát hiện alen G: 5'-tcttaccaaacaaagcatgtg-3', phát 
hiện alen A: 5'-tcttaccaaacaaagcatgta-3'; và mồi ngược: 5'-gtcattcccactaccacctg-3'. Chu trình nhiệt 
của phản ứng PCR được tối ưu hóa là: 94oC (3 phút) và 34 chu kỳ: biến tính ở 94oC (30 giây), gắn 
mồi ở 54oC (40 giây), kéo dài ở 72oC (30 giây), bước kéo dài cuối ở 72oC (8 phút), kết thúc ở 4oC. 
Sản phẩm PCR 208 bp được phát hiện trên gel agarose 2,5% nhuộm redsafe. Kiểu gen được kiểm 
tra bằng phương pháp giải trình tự gen. Trong toàn bộ mẫu, tỉ lệ kiểu gen GG là lớn nhất (57,5%) 
và AA là thấp nhất (4%). Tần số của các alen G và A lần lượt là 0,77 và 0,23. 
Từ khóa: Thụ thể Melanocortin-4; đa hình nucleotide đơn; rs12970134; phương pháp AS-PCR; 
trẻ mầm non. 
Ngày nhận bài: 09/02/2020; Ngày hoàn thiện: 27/4/2020; Ngày đăng: 28/4/2020 
* Corresponding author. Email: [email protected] 
DOI: https://doi.org/10.34238/tnu-jst.2020.05.2604
Nguyen Thi Trung Thu et al. TNU Journal of Science and Technology 225(05): 38 - 44 
 Email: [email protected] 39 
1. Introduction 
Melanocortin-4 receptor (MC4R) gene is 
located on chromosome 18q22 [1]. MC4R, a 
G protein-coupled receptor is expressed in the 
developing autonomic and central nervous 
systems [2]. Activation of melanocortin-4-
receptors (MC4Rs) reduces body fat stores by 
decreasing food intake and increasing energy 
expenditure [1]. Activation of MC4R proteins 
reduces body fat stores by decreasing food 
intake and increasing energy expenditure [1]. 
Mutations in the MC4R leads to a reduced 
receptor function found in 2–4% of extremely 
obese individuals [3]. Previous studies 
demonstrated several MC4R variants and 
common genetic polymorphisms near the 
MC4R gene contributing to different levels of 
obesity [4]. 
Recent genome wide scans found common 
variants near MC4R were related to obesity 
and insulin resistance such as rs17782313, 
rs17700633, rs12970134, rs477181, 
rs502933, and rs4450508. Among these 
variants, rs12970134 (A/G) located 154 kb 
downstream of MC4R has been studied most 
often. Many studies reported the association 
of rs12970134 MC4R variant with several 
obesity-related traits (such as: waist 
circumference, BMI) [4], [5], central obesity 
[6], [7] and insulin resistance [4], polycystic 
ovary syndrome [8], coronary artery disease 
[9]. Whe ... otide at the 3’-end of the primer 
perfectly complements the base at the variant 
or wild-type sequences. After the PCR and 
electrophoresis, the patterns of specific PCR 
products allow the differentiations of the SNP 
to determine whether the genotype was 
homozygous wild type, heterozygous or 
homozygous variant [14]. This method is 
relatively cheaper than other available 
methods. However, in order to create a 
working AS-PCR-based genotyping system, it 
needs to design primers and well optimized 
PCR conditions. 
Thus, this study aimed to find out a protocol 
for genotyping rs12970134 near MC4R by 
using AS-PCR and analyze the genotype and 
allele ratio of this SNP in Hanoi preschool 
chidren population. 
2. Research methodology 
2.1. Subjects and data collection 
In this study, 300 preschool children (36-60 
months of age, 150 males and 150 females) in 
Hanoi with normal nutritional status, 
randomly were selected from the subjects of 
project B2018-SPH50 - a cross-sectional 
study identifying Kinh ethnic representing the 
major ethnic of Vietnam. 
Classification of nutrition status of children 
was performed according to WHO 2006 
criteria; normal nutritional status were 
children with Z-score BMI by age and gender 
ranged from -2 to 2. 
Nguyen Thi Trung Thu et al. TNU Journal of Science and Technology 225(05): 38 - 44 
 Email: [email protected] 40 
The exclusion criteria were children with 
acute or chronic diseases such as tuberculosis, 
HIV/AIDS. 
Samples of cheek mucosa cells were taken 
with the consent of parents or official 
guardians. The project was approved by the 
Medical Ethics Council of the Institute of 
Nutrition with Decision No. 343/VDD-QLKH 
on July 27, 2018. 
2.2. DNA extraction method 
DNA was extracted from the sample of the 
cheek mucosa cell by using the GeneJET 
Genomic DNA Purification kit (Thermo, 
USA) according to the manufacturer's 
instructions. 
2.3. Genotyping method 
Protocol of genotyping SNP rs1137101 by AS-
PCR method included the following steps: 
2.3.1. Design primers 
Nucleotide sequence of DNA fragments 
containing SNP rs12970134 on NCBI 
database [15] was used to design three of 
PCR primers (including wildtype and mutant 
primers to detect 2 alleles (G or A) and one 
common primer. Designing wildtype and 
mutant primers to identify G or A allele of 
rs12970134 near MC4R gene was based on 
Wangkuhang et al. [16]. Next, last primer was 
designed by using Oligo 7 Primer Analysis 
Software [17] and UCSC In-Silico PCR 
online [18] to choose pairs of primers that 
have homologous melting temperature (Tm) 
and don’t match each other. The melting 
temperature of the primers was approximately 
54°C according to recommendations of the 
above software. 
2.3.2. Optimal protocol design for polymerase 
chain reaction 
To genotype rs12970134 polymorphism using 
AS-PCR, each genotype was determined by 
two independent reactions of A and G alleles. 
The composition of each PCR reaction 
consists of 0.8 µL of nuclease-free water, 2.5 
µL master mix Dream Taq Green (containing: 
0.4 mM Dream Taq DNA polymerase, 0.4 
mM 2X Dream Taq Green buffer, 0.4 mM 
dATP, 0.4 mM dCTP, 0.4 mM dGTP, 0.4 
mM dTTP and 4 mM MgCl2), 0.35 µL for 
each primer (concentration 10 pmol), 1.5 µL 
of DNA sample (concentration 37-60 ng/µl) 
in a total volume of 5.5 µL. 
The gradient PCR method was used to 
determine the annealing temperature. The 
PCR conditions were as follows: 3 min at 
94
o
C, 34 cycles of 30 sec at 94
0
C, 30 sec at 
52
o
C/54
o
C/56
o
C, 30 sec at 72
o
C, final 
extension 8 min at 72
o
C, chilling at 4
o
C. PCR 
products (208-bp band) were detected on the 
redsafe-stained 2.5% agarose gel by the 
electrophoresis in 0.5X TBE buffer. The 
DNA band was taken by using Geldoc-It
TM
gel camera. The optimal protocol was 
recruited from the results of trials. 
2.4. Statistical analysis 
Genotype and allele frequencies are expressed 
in %. Add the Hardy-Weinberg equation to 
identify allele frequencies. 
3. Results and discussion 
3.1. Optimize the protocol of genotyping 
MC4R rs12970134 
3.1.1. Design the primers 
The results showed 5 oligos used to perform 
the AS-PCR. But all products were so short, 
that we only chose wildtype and mutant 
forward primers. The sequences of wildtype 
and forward primers were 5’-
TCTTACCAAACAAAGCATGTG-3’, and 
5’-TCTTACCAAACAAAGCATGTA-3’. 
The sequence of common reverse primer was 
5’- GTCATTCCCACTACCACCTG-3’. The 
theorical PCR product was a 208-bp in length: 
TCTTACCAAACAAAGCATGT(G/A)caaac
aaagatttatcagaagggtgcttgttagtacctgtattcaaaggg
agaactagtcaaacctcaaaggggcaaggccaaccaggacc
aacctagcagggcaagcatgtctccacactgcctatcttcagat
gagcatttttttcctttaggcaagtttttcCAGGTGGTAG
TGGGAATGAC 
Nguyen Thi Trung Thu et al. TNU Journal of Science and Technology 225(05): 38 - 44 
 Email: [email protected] 41 
3.1.2. Determination of the annealing temperature of the gradient PCR 
Figure 1. Electrophoresis image of gradient PCR products 
Ta: Temperature of annealing, (-): negative control, M: CSL-MDNA-100bp DNA Ladder RTU 
Genotype: 1 (GG), 2 (AG), 3 (AA) 
Figure 1 showed that at Ta = 54
o
C, the amplified band was the thickest and easy to determine G 
and A alleles. Thus, the optimized PCR protocol was 94
o
C for 3 min and 34 cycles of 
denaturation at 94
o
C for 30 sec, primer annealing at 54
o
C for 40 sec, primer extension at 72
o
C for 
30 sec, final extension at 72
o
C for 8 min, stopped by chilling at 4
o
C. 
3.2. Result of validation 
To validate AS-PCR method, two products of A allele from sample 2 and G allele from sample 1 
were verified by sequencing with reverse primer: 5’- GTCATTCCCACTACCACCTG-3’ (Figure 
2). The obtained sequences from sequencing are single strands and complementary to the single 
PCR product sequence above (3.1.1). 
Genotypes were analyzed by 
AS-PCR method 
Result of sequencing method 
Allele A 
(sample 2) 
Allele G (Sample 1) 
Figure 2. Allele A and G products were validated by sequencing method 
Thus, the genotypes identified by using AS-PCR method were completed in concordance with 
those of the sequencing method. Consequently, we used the optimized AS-PCR protocol to 
genotype 200 samples and the results are presented in Figure 3. 
Nguyen Thi Trung Thu et al. TNU Journal of Science and Technology 225(05): 38 - 44 
 Email: [email protected] 42 
Figure 3. Electrophoresis image of AS-PCR products with some samples 
(-) : negative control, M: CSL-MDNA-100bp DNA Ladder RTU 
Genotype: 1 (GG), 2 (AG), 3 (AA), 4 (AG), 5 (GG), 6 (AG), 7 (GG), 8 (GG), 9 (GG), 10 (GG), 11 (GG), 
12 (GG), 13 (GG), 14 (GG), 15 (GG), 16 (GG), 17 (AG), 18 (GG). 
3.3. Frequencies of MC4R rs12970134 
polymorphism in Hanoi preschool children 
Children were chosen equally by gender (50% 
boy) and age group (3-5 years: 25% (3–3.5 
years), 25% (3.5–4 years), 25% (4–4.5 years), 
25% (4.5–5 years)). The anthropometric 
indicators of 200 normal children (WHO 
2006 criteria) were represented in our current 
publication [19]. 
The frequencies of genotypes and alleles of 
MC4R rs12970134 polymorphism among 
these children is shown in Table 1. 
Table 1. Genotype and allele frequencies of 
MC4R rs12970134 polymorphism in Hanoi 3-5 
years old children 
MC4R rs12970134 Number 
(Frequencies) 
Genotype 
GG 115 (57.5%) 
AG 77 (38.5%) 
AA 8 (4.0%) 
Allele 
G 307 (77%) 
A 93 (23%) 
P HWE 0.265 
The data in the table are presented by n (%), 
HWE: Hardy-Weinberg equation, P value were 
from test 2 or Fisher exact. 
In the entire samples, the GG genotype was 
the highest (57.5%), and the AA genotype 
was the lowest (4%). The frequencies of the 
G and A alleles were 0.77 and 0.23, 
respectively. The frequencies of rs12970134 
genotypes in samples of preschool children in 
Hanoi were in the Hardy – Weinberg 
distribution (P = 0.265). 
The frequencies of rs12970134 genotypes in 
different populations varied significantly 
around the world [20]. The heterogeneity of 
the proportions of alleles in different 
populations was influenced by ethnic 
characteristics. According to Marth (2004), 
the history and characteristics of nation 
formation have a great influence on its 
biological characteristics, anthropology, and 
genetic background [21]. In the Hanoi 
primary school children population, the 
frequency of minor A allele was 0.23. This 
result was the same with other populations 
[20]. The ratio of genotypes in our study is 
almost equal to the frequencies in the 
Japanese in Tokyo, Japan (JPT) [20]. 
The limitation of this study is that the 
genotyping method identifies only one SNP 
genotype for one procedure. Also in this 
study, the frequencies of alleles and 
genotypes were determined only in children 
with normal physical development in Hanoi, 
and not the entire population of Vietnam. 
Further research is required large samples that 
are representative of the entire population, and 
the inclusion of children with nutritional 
disorders, children from different ethnic groups. 
Nguyen Thi Trung Thu et al. TNU Journal of Science and Technology 225(05): 38 - 44 
 Email: [email protected] 43 
4. Conclusions 
This research shows the AS-PCR method for 
genotyping MC4R rs12970134 polymorphism 
in Vietnam’s laboratories. This protocol used 
the forward primers (5’-
tcttaccaaacaaagcatgtg-3’ to detect allele G, 
and 5’-tcttaccaaacaaagcatgta-3’ to detect 
allele A), and the reverse primer (5’- 
gtcattcccactaccacctg-3’). The temperature to 
anneal primer was 54
0
C. 
Among children aged 3-5 years in Hanoi, the 
frequency of GG genotype was the highest 
(57.5%) and the frequency of AA genotype 
was the smallest (4%). The method for 
identifying genotypes in this study was 
developed and optimized to ensure data 
accuracy, reduce costs, and can be used in 
many molecular biology laboratories to 
identify the MC4R rs12970134 genotype with 
large sample sizes. 
Acknowledgments 
The authors would like to thank Laboratory 
Center at Institute for Preventive Medicine 
and Public Health for kindly helps and 
supports. The study was supported by 
Ministry of Education and Training, Vietnam, 
grant no B2018 - SPH50. The research 
protocol was approved by The Ethics 
Committee of the National Institute of 
Nutrition, Vietnam. 
REFERENCES 
[1]. N. Balthasar et al., "Divergence of 
melanocortin pathways in the control of food 
intake and energy expenditure," Cell, vol. 
123, no. 3, pp. 493-505, 2005. 
[2]. K. G. Mountjoy and J. M. Wild, 
"Melanocortin-4 receptor mRNA expression 
in the developing autonomic and central 
nervous systems," Developmental brain 
research, vol. 107, no. 2, pp. 309-314, 1998. 
[3]. F. Geller et al., "Melanocortin-4 receptor gene 
variant I103 is negatively associated with 
obesity," The American Journal of Human 
Genetics, vol. 74, no. 3, pp. 572-581, 2004. 
[4]. J. C. Chambers et al., "Common genetic 
variation near MC4R is associated with waist 
circumference and insulin resistance," Nature 
genetics, vol. 40, no. 6, p. 716, 2008. 
[5]. D. Albuquerque, C. Nóbrega, R. Rodríguez-
López, and L. Manco, "Association study of 
common polymorphisms in MSRA, TFAP2B, 
MC4R, NRXN3, PPARGC1A, T MEM18, 
SEC16B, HOXB5 and OLFM4 genes with 
obesity-related traits among Portuguese 
children," Journal of human genetics, vol. 59, 
no. 6, p. 307, 2014. 
[6]. L. F. Been et al., "Replication of association 
between a common variant near 
melanocortin‐4 receptor gene and 
obesity‐related traits in Asian Sikhs," Obesity, 
vol. 18, no. 2, pp. 425-429, 2010. 
[7]. O. P. Dwivedi et al., "Strong influence of 
variants near MC4R on adiposity in children 
and adults: a cross-sectional study in Indian 
population," Journal of human genetics, vol. 
58, no. 1, pp. 27, 2013. 
[8]. A. A. Batarfi et al., "MC4R variants 
rs12970134 and rs17782313 are associated 
with obese polycystic ovary syndrome 
patients in the Western region of Saudi 
Arabia," BMC medical genetics, vol. 20, no. 
1, pp. 144, 2019. 
[9]. H. Huang et al., "Implication of genetic 
variants near TMEM18, BCDIN3D/FAIM2, 
and MC4R with coronary artery disease and 
obesity in Chinese: a angiography-based 
study," Molecular biology reports, vol. 39, 
no. 2, pp. 1739-1744, 2012. 
[10]. M. Bazzi et al., "Association between FTO, 
MC4R, SLC30A8, and KCNQ1 gene variants 
and type 2 diabetes in Saudi population," 
Genet Mol Res, vol. 13, no. 4, pp. 10194-
10203, 2014. 
[11]. B. Xi et al., "Association between common 
polymorphism near the MC4R gene and 
obesity risk: a systematic review and meta-
analysis," PloS one, vol. 7, no. 9, p. e45731, 
2012. 
[12]. D. P. Zobel et al., "Variants near MC4R are 
associated with obesity and influence obesity-
related quantitative traits in a population of 
middle-aged people: studies of 14,940 
Danes," Diabetes, vol. 58, no. 3, pp. 757-764, 
2009. 
[13]. R. J. Loos et al., "Common variants near 
MC4R are associated with fat mass, weight 
and risk of obesity," Nature genetics, vol. 40, 
no. 6, p. 768, 2008. 
[14]. M. N. Darawi et al., "Allele-specific 
polymerase chain reaction for the detection of 
Alzheimer’s disease-related single nucleotide 
Nguyen Thi Trung Thu et al. TNU Journal of Science and Technology 225(05): 38 - 44 
 Email: [email protected] 44 
polymorphisms," BMC medical genetics, vol. 
14, no. 1, p. 27, 2013. 
[15]. National Center for Biotechnology 
Information, "dbSNP short genetic 
variations", 2019. [Online]. Available: 
https://www.ncbi.nlm.nih.gov/projects/SNP/s
np_ref.cgi?do_not_redirect&rs=rs12970134. 
[Accessed Aug. 11, 2019]. 
[16]. P. Wangkumhang et al., "WASP: a Web-
based Allele-Specific PCR assay designing 
tool for detecting SNPs and mutations," BMC 
Genomics, vol. 8, no. 1, pp. 275-283, 2007. 
[17]. W. Rychlik, Oligo 7. [CD-ROM]. Cascade, 
Co: Molecular Biology Insights, 2009. 
[18]. J. Kent, "UCSC In-Silico PCR", 2013. 
[Online]. Available: 
d=start. [Accessed Aug. 12, 2019]. 
[19]. D. T. T. Le, T. T. T. Nguyen, N. V. Savvina, 
and T. T. Le, "Genotyping method and 
frequency of genotypes of single nucleotide 
polymorphism of the leptin receptor gene 
(LEPR-rs1137101) in preschool children in 
Vietnam," (In Russia), Pediatria named after 
G.N. Speransky, vol. 99, no. 1, pp. 121-126, 
2020. 
[20]. MediaWiki and National Center for 
Biotechnology Information, “SNPedia”, Dec. 
07, 2019. [Online]. Available: 
https://www.snpedia.com/index.php/Rs12970
134. [Accessed Feb. 7, 2020]. 
[21]. G. T. Marth, E. Czabarka, J. Murvai, and S. 
T. Sherry, "The allele frequency spectrum in 
genome-wide human variation data reveals 
signals of differential demographic history in 
three large world populations," Genetics, vol. 
166, no. 1, pp. 351-372, 2004. 

File đính kèm:

  • pdfgenotyping_method_and_frequency_of_single_nucleotide_polymor.pdf